EST 44291 is a singleton


Sequence

>44291 (1 EST) Length=261 ATTTTATTAAAATGTGCTCAAACGGCATTAAATTCAAAATTAGTTTCTAATCATAAAGAATTTTTTGGTGAGTTAGTTGT TAATGCTGTTTATAAATTAGGTGATAATTTAGATAAATCTAATATAGGTATAANNNNAGTTACAGGAGGTTCTTGTTTAG ATACTCAATTAATTTATGGTGTTGCATTTAANANNNCATTTTCTTATGCTGGTTTTGAACAACAATCAAAAAANTTTATT AATCCAAAAATTTTATTATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 44291: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44291463038T182520654c3czapPFDd2.1, Debopam Chakrabarti


Date: 14:39:23 on Sun 19 Nov 117.