EST 44292 is a singleton


Sequence

>44292 (1 EST) Length=342 AAATTATGTTCCAACTATATAAGTGACTTTTTAAATATACCATGTAGTGCTTTGTCAGGGGCTAACATAGCGATGGATGT GGCCATGGAAAATTTTTCANAAGGTACCNTAGGNGGTAATGATAAGGACTCCCTAGTTATATGGCAAAGAGTTTTTGACT TACCCTACTTTAAAATTAATTGTGTAAATGAAACGATCGAAGTTGAGATTTGCGGANCTCCTTAAAAATATTATCACCTT AGNTTGCGGATTTTNTGATGGTTTAAATTTACCTACAAATTCCAAGTCAGCTATAATAAGGAATGGNNTAAACGNAAATG ATATTATTTGGNAAAGTATTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 44292: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44292463039T182530675c3czapPFDd2.1, Debopam Chakrabarti


Date: 9:33:24 on Fri 24 Nov 117.