EST 443794 is a singleton


Sequence

>443794 (1 EST) Length=295 GGCAAATTGTAAGCGTTAATATTTTGGTTAAAATTCGCGTTAAATTTTTGGTTAAATCAGCTCATTTTTTAACCAATAGG CCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGT CCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTTTCAGGGGGGATGGGCCACTACGTTAANCAT CANCCTAATCAAGTTTTTGGGGGTCGAGGTGCCGTAAAGCACTAAATCGGANCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 443794: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4437941166371N42340SMNHADA019085SKSmAW


Date: 4:39:26 on Wed 22 Nov 117.