EST 444532 is a singleton


Sequence

>444532 (1 EST) Length=471 GATTCANNATGGTTAATCATTGTTCAATATTTGTTTGGCAGCTACGTGCCAGCATAACTTATATGGATATTTGGCTGATT TGCCAACATCTTGTAAACAACGTTTGCTCGAATTCTTTAGCTCACATGACCAGTTATTTCTATCAGAATGCGCTCAACTT GTATCATCACCTTCATTTGGAAGAAATCTTACGGAATTACGTTTTTATCTGAGCGATCAAGTGACTGATAGTGTTCTGGA AGCCATTGCGGCTCATAATCGTGCACTTCAACAAATTGCAATTATTTCTGGTCAAAACATCACTGACAAGGGTATTCGTG CAATAACAAGTGGACAACGAAAGATCGAGAAATTAGAATTTAGAGCTTTGAAGAAGCTTACATCAAATGGTTTATCACTG ATAAAGTCAAATTTCTTTACACACAGGTCGACCTAAGCTCTTGCATTAAAGATCAAAAAGCGANGGGATCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 444532: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4445321167333N43031SW3ICA1027SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 0:9:53 on Sun 19 Nov 117.