EST 444539 is a singleton


Sequence

>444539 (1 EST) Length=387 CACGTATTCGGGCTTGTTCGCCGAATAACGGCGTTCTAGTGGCTTCTACCACGGATGCTTATCGTTTGGGAAATTTTAAC CAGTGCATATTTCCTTTCCAACATCAAAATTGCAAGACTAACCAATGCACCCAATGAACGGCCCAACATACAGTATCCGA ACACTCCAACAGATATAGGAACACTGGAAGCAGCAATCGGTAATAGCTTCAATGCTGCAATACCACATCCAGTAGCTGTA CCGNATACAGTGATGCTACCACTAAATTTTATACAACAGTTGACTTGTCCATTNCGCTTAGATATTACTTCTGCTGCTAT TGCACATGTAGGATACGGCTGCAGCTGCAGCTTCAGCAGNTGNCACTACAATATGCAATATTGGATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 444539: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4445391167340N43038SW3ICA1034SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 4:24:10 on Fri 24 Nov 117.