EST 444544 is a singleton


Sequence

>444544 (1 EST) Length=301 TGGGTGATGAAGATAACGAAGTTGGTCTTCCTCAAAAGGGTCTCAATATGATTATCAAAGATGTGATACCGGAGATGAGA GTGGCCAATGAATCGCGTGAACTGCTGAATGCTTGTTGTGTGGAGTTTGTTAGACATATATCACGGGAGGCGCAGCGTAT TTCGGCAGATGATCAGCGCAAAACTATATATCATGAACATGTGCAAAAAGCTCTAATAAATTTGGCTTTCCCATATGATT ATGTTGAAGCAGCGGACAGTGTGCTTAGTGAGTGTAAAATAGCAGCGGAAAATAATTTAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 444544: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4445441167345N43043SW3ICA1039SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 3:55:35 on Sat 18 Nov 117.