EST 444549 is a singleton


Sequence

>444549 (1 EST) Length=359 TCTAACTTGACTAAGGACTTGTCTCGTGACCAAAAGTGCCAACAGACGAGCANTGCTCTAGTACCATCAATCATGGGTNC ATNAGAAACAGCGAATCGTGGTGNTGGATGTATACCTCGGATATATCTGTATATAGTGATAGTGGAATCATACTGCTTGT GATATGCTCCGAGGTGCTATTGGAAGTATGCAATGGGAATGTTATAGGGTTGANGAAATGGAACTGGAGTATCGCTAATA NGCGATGATCTCATGTCTGACTNACNTANCGNCGATCTAGATGAGTGAGTTGACNGAAGCANGCACAACAATGTTNNGTG CATGNTCTNTTGCGATATTATGCATATGGTNGNTCCCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 444549: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4445491167350N43048SW3ICA1044SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 20:6:36 on Sat 18 Nov 117.