EST 444573 is a singleton


Sequence

>444573 (1 EST) Length=426 GAGAATGAGAGTGTTGACACGAATTTGCTGTTATTTGCTGTTGGCCTGATTGTTATTGCAGATCGACCGATGCGATGCTA TCAATGTAATTCAGCGAACGATGCAAACTGTGATTCGAGTGATGCTAAAGATCTGAATCAATATACCAAGTTATGTCCAT TACTGAAGGATGGTACCTATGCCGGTAATAAACCTATTGCATGCCGTAAAATTGTTCAAAGCGTAGAAGAGTTACCAGCG CAAATAATTAGAGAGTGTGCATATACGGGTTGATAAGCAGTTAGACGGAATACGCAAACAGGGCAAATAAAGCTGTCAAA TTNGTTGTNTTTACCAATTGGGAAAAATTGTNAAACGGGGGATNTTCCTGGCAATGGGTNCAACAACAAGATTANCGACA ACGATTTTTTCTCCTGGGACCCCCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 444573: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4445731167374N43130SW3ICA1077SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 19:45:44 on Fri 17 Nov 117.