EST 444577 is a singleton


Sequence

>444577 (1 EST) Length=376 AATGGATTGNCTCGGGACTCACACGTGACAGCAGACGAGCAATGATATAGTAACACCAGTCAGGGATACAATTAAAACAA CGATATTNGTTGTAGTATGTATACCATTGGATATATATGTATATAATGAAAGAGCAATCATNCCGGATGTGAANANCTCC GATGTNCTATCGGCNGCATATTATTGGACTTGTATTGTCTCGTCAGATGGAAATTTAANTTGGGNTGGTACCCGAAGAAA ANTCATGCATGATTGAANTTNAGAGATGTAGATGAATGAATGAATGAAAACCATAGTNCAACATCNNNCATGCATGATGT TTTTANGCCTATATGCCAATAACAATTGGTTTCGCGTAAGCTGATTCCTNNCAAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 444577: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4445771167378N43073SW3ICA1081SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 12:37:59 on Fri 17 Nov 117.