EST 444601 is a singleton


Sequence

>444601 (1 EST) Length=380 TATTCATTACACAAAAAATAACGCAGGAAATCGGTGGTCAGTGGATTCCNTATTGGACCCGGCGGGATTCTTTCAGGATC TTTTGTTTGGGAACAATCCGTTAGTCCCAGGATCTCGGCTTTCGCAGATGACACATGGCAANGGATATTATTGCTGCATA TGCATCACCGGTAGCACTGATACACACCACCTTTTCAAGCCTTGGTGGAAGANTCAAACCGAAAATTCAATTTCCTGAAA GGATTTATTTGGGGGGCTAGGGGAGGANGGATTCCCAGGAGGGCCACCCCGGACCCCGAGGGGGAATTTGGTGGAAAAGG GGCAAGNTTGTTTTTAGGGTGGGGATTGGNCACCCCGGGCCCCCCGGTTTNCGCCCCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 444601: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4446011167402N43097SW3ICA1106SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 21:17:40 on Fri 24 Nov 117.