EST 444604 is a singleton


Sequence

>444604 (1 EST) Length=434 TTTGAGANTAACAATGAAGAATTTATTTCAAGTGTTAGTATTTGTTGGATTGACGCTGCTTGAGATAAGCTTAAGTGAAG ATGATGGAAGGCAACCGAAGGAAGCGACCTATAAGAAATTCGTTGGTGAAAGACACTATATGATACCATTTAAAACTCGA ATTAGTCAACCATTCCAAGAAGGACAGACCATTCATGGAGTTGGTGTGATAAAATCCGATGCCAAAAGAATTGATATCAA TTTCCATAAAGGCGCAGGTGCAAATGTTGATCTACCGTTGNACCTCAGTATCCGGTTTGATGAAGGAAAAATGGTCTACA AATTCATACATGAACAACGTTTGGGGGCAGTAAAGAGCAACGATTAAAAAATCTTTTTTAAGCCAAATATGGAAATTGGT TTTTCCGANTTCGCATTNATCAATAATAANTTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 444604: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4446041167405N43100SW3ICA935SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 16:45:54 on Wed 22 Nov 117.