EST 444605 is a singleton


Sequence

>444605 (1 EST) Length=484 AAAATACNAATTGGAATGAATGCNCNGTATTCNCTTNGCAGTGGTCNCTCNAATTCCAGTGATAACTCNAACAACNCGTC CGGAGATAATAACATAAATAATAGCAGTGCAAATAATAATGGAAGGCATAAGAAAGGAGTGCGATTTGAAAATGTGAAAA TCTACCTTTTCGAGAGAACACAGGGATTTGATGTTGTNCCGNCGTCTGGTGGCTTTGCACTTGGAATGCAAAAGAAGCAT TTNGATATACGTGAAGTTGCACTCCACAGTAAAATGGCCAGTAATAACATAACTANGTCTCAAAGATAACAAATTGCCTA CAAAAAATTTGGGTNTGAGCAAGTNTTGCACGGTGTCAGCTTAGACGTAAACGAAAGTNTTTGTNATGCTTNGGGCGAAA AACTCTTGTNGNGACAAAAGCGGNTTAAGAATTAGNGATGGNTCAAATGGNCAAAACGAAGGGGATTACAAACGACTACA AATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 444605: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4446051167406N43101SW3ICA936SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 1:55:47 on Sat 18 Nov 117.