EST 444616 is a singleton


Sequence

>444616 (1 EST) Length=367 CGCGCGCACATGTTCCTCACGAGGACGGAGTACGACCGCGGCGTGAACACCTTCTCCCCGGAGGGGCGGCTGTTCCAGGT CGAGTACGCCATAGAGGCAATCAAGGTGAGTGAGCCTGCCTACCTCTCCTGAGCACCCCTCTTTTGCTCTCGATCTCGGT TTAGATTTGGTGAGGAGGCAGCTGCAGCGCGCTGTTACGAATCGGTTTGTCTGCGCCACGCGAGCGGCGGCGATGCGGTG GCTGCCCTGCTGGAGTCCAGGGTTCGTTTGGGGGCGATCTTTGCGTTAGGTTGCCTGGTTCCGTGGTTTTTCGTTGTATT GAACTGATGTTGGGGCTCTACTGCTATTGGNTTGAAGACGAAGATGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 444616: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4446161167417N43112SW3ICA947SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 21:12:41 on Fri 24 Nov 117.