EST 444630 is a singleton


Sequence

>444630 (1 EST) Length=385 ATAATATAAGGGAAATTTCCCGGATGTTTCCATTGAGGGGAGGAAGCATTGCTGTAAATCAAGTGATTGGAAGCAGGTAG CACAAACTCCTTGCTTGTCCGATATTTAGAAATAAAATAGTTCCATAACATTATTTGGGGTGTATTTCGAGATTCTAATA TAGTTTCATTTGTGGGATGCTGTCCTAGCATTACCATGAAGATGTACTGCGTTTTATTATCTGGAAATGCTGGCGTGCGA GAAACAGGAAGGGTNCTCTATAAGTTGCTGATAGTCTGACTGCAATACTTTGGGGGTTGACAAATNACAATNTGAACTTC TTTCTTGAAGACCCANCGGCAGTTTAGTCCCGATATTTTTGTCATCCANNCATCGGGATTTTNCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 444630: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4446301167431N43126SW3ICA964SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 0:0:53 on Sun 19 Nov 117.