EST 444632 is a singleton


Sequence

>444632 (1 EST) Length=214 AAAAAGTTTCCATAAAATTTACTTAGTACNACNATTATGAAAGATTTATTTATTTCATAAAATTAAATTTGGTTTTTTAA AATCTGAATTATGCTAACAATTTTAGTACTGTTGGTACCATAAATTATTGTTTGGTCAGTGTACACATGTTTTATCTCAT ACTTCTCATTCCATCAGAATTTTTCTACTTCAACAGATGATTAAAAATTGGTGN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 444632: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4446321167433N43131SWMFCA326SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 0:29:23 on Sat 25 Nov 117.