EST 444633 is a singleton


Sequence

>444633 (1 EST) Length=500 CAAATGATGAATACGATGCNGGATATGGAAGAACCGAAGGATATGGAAGAGGGGATGGTTATTCTCGTGGTGATGGATAT TACAGTAGAGGAGGAGGACGAGGTGGATTTGGTCGTGGTGATGGTGGTTATGGCCGTGGAGGATATGCACGTGGAAGAGG AAGTGCTGGTCTCTACGAAGATGAACGTGATTTTTACAATGGCGATGGTCCTGTGATGATGATTTATGGTATTGATCAGG ATAATTTTAACTGCGACAAATTATTTAATCTGTTGTGTCTTTATGGTAACTGCAATAAGATAAAATTTATGAAGTCGAAA ACTGATACGGCTATGGNCCAATTAGGTAGCGTACGCCAAGTCTACACAACAATCGACAATTTGCATGGCACCATGATTGN TGGCAATAAACTTGGCCTCAGACCATCGAAACAGGAAATTTTGGACGAAATACGTNATCCCGTTTTATTTGCCGGATGGA CGCCTCCATCAAGAGATTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 444633: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4446331167434N43132SWMFCA327SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 14:15:52 on Mon 20 Nov 117.