EST 444638 is a singleton


Sequence

>444638 (1 EST) Length=500 CGGCGGACATAACAGTAGTATATGCTAGATGTCAAGTGTGCAACTTATCAAAAAACGAACATCTGTTATTGCTTTGCGAC GGAATCGTNGGACAGGATGTAGACGGAAGTTTAGTTCGNNGTNATGCTGCATGCCANTGTTATTGCCTACCGGAAAAATN NGACAGTGTNCCAGACGGAGACTGGTTGNGNACTTTCTGTGCTGANATANGAGCTACCCACGAATCAGTGTACAACAGCC GATACGCACGAGAAAANCATCCGNCATCATCAGATTACCACGAATTCATAGATTNNAGGGAATCTGGAATCTCGAATNAG GATGACCAGNGCTAGTGGNATAAATCAGAGCTTCGATTGAGAGGGTGTGGGNGTGGTTTCATAGCGATAAGTGTTTAATT AAATCGGGCTCAAACAGTGTAANGACAGTGCGAGCGATGATGATGATAATGCTGATTGNGACAATCAGGACGATAGGGTT TGGCAGCAGATTAGATNTNG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 444638: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4446381167439N43137SWMFCA333SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 1:23:35 on Tue 21 Nov 117.