EST 444642 is a singleton


Sequence

>444642 (1 EST) Length=452 GAAAAACGCTTCATCACAACCTCATGCATGGAATCAGATGGCTTCTATAGTTTATATAGAATCACCTGCTGGAGTCGGTT ATTCATATTCTACCAATGGGATTATTAAAACCGATGATAACCAGACAGCGCAGGAGAATTATGTGGCAATCAAAGAATTT TTCAAAGCTTTCCCAAACTTCCGTAATAATTCTGTCTATATCATGGGAGAAAGTTATGGTGGCGTTTACGTACCGACATT AACTGTTCTTGTTATTCGTGGTCTCGCAGAATTCCCGATGAATCTAAAGGGCATCGCACTTGGAAATGGATACGTCAGTG AGGTGCTAAATATAGATACATCAATACAGGTCGCTTACAGGCACGGATTGGTTGATGAAAAAACGTGGGAATGAGCTCCA AAACCGGTGTTGNCATGGCTGTATTAATACATGTGACTGACAAATGTCACCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 444642: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4446421167443N43141SWMFCA337SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 0:51:33 on Fri 24 Nov 117.