EST 444720 is a singleton


Sequence

>444720 (1 EST) Length=144 GTTATTTACAGATTTGNNTGCCGTTTTCCCAGTCATATTGCAAATTTCATTTCATCTATGTTGATTTTGGGAAAATTCTT TAATATATTGGCCTGCTATGCTTCTGTATTTTNGGTATGTTGATGAGAGTAAATTTGCTCTAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 444720: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4447201167617N43235SW3ICA599SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 18:58:22 on Sun 19 Nov 117.