EST 444741 is a singleton


Sequence

>444741 (1 EST) Length=455 CCGGAATTGAAATGGATGAAAGATTGGAGACCAATCGTAGGATCATCTCACGTTAGTTTTACACGTGGAAGGTTCATTAT GCTCATTGATCATTAATGAACCGNGGTGGTGCGATTGCGGAATTTATTCCGTCGTAGCCATAAACGATGCTGGAACAGNG ACAACATCGNNTTCAGTNACTATCGAAGCTGACGGTGACTTCAGCATGATGCATGATNTTCGAAAGGAAANTTCTCGCAT AACGCTGGAAGCTCGTAAAGTTCGAGAAATTTATGAAATTGATGAAAATGATGAAAAAGCTGCAGCTGCTGGTGCAACAT TTCACGTCACGGAACTCACCACACGTNAACGTTACTTGGCCCAATTACGTGGTTTGGGATGAAAATCTAGCACGTAATAT TGAAATTGCAAAATGGGTTGGNTCATCCAAGTTTCCANTCAACTTCAACAAGGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 444741: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4447411167638N43256SW3ICA692SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 4:33:46 on Mon 20 Nov 117.