EST 444768 is a singleton


Sequence

>444768 (1 EST) Length=193 AACAGAATGTTGGTATAGGATGAACACTACAATTGAATTAAGTANCTCAACACTTGACAAAGNNCAGGGATGGTNTNTGG ATGAGCGTCAGCGTGCAATAAAAGTTGCATTGATGATGATGTTTGAACAGCANCCCCCACTCATGAGAGCATTATTAGAT ACGGGAGATGCGCTGTTGGTTTACTNCTCAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 444768: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4447681167665N43283SW3ICA752SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 22:57:46 on Wed 22 Nov 117.