EST 444893 is a singleton


Sequence

>444893 (1 EST) Length=490 ACCCAAGTTTGAGGTCACTTTCTTATTCAGTCAAACAATCAGTCATCTATAAATGGGAACATTTACACTGAAGTACTTTT TCAAGAAAGCAATTTGGGAGAAGAAAACACTGTGGGCATCGGTAGCTGTAATGGCGTATCTCGGTTACTGCTTCGATCGG CAAGGTATGTATAAAGCAAGCATGATGAAAGGACAAAGCAAGATGTTTGCAGATCGAATTGCTGAAATACCGGAGGGTGA GGATATCTGGAAGTACTAGTTATTATTTGTCTCTAGTTCTCGAATCATATGTACACATGTAGGATTCATCATAACCATTT ACCAAAACTATTCTTTTCTTCGTTTGACCTTCTGTCTGGCATGTTTCTCTCAAGTAATTTTGAACATTGGAATTTTAAGA TCACTCTTCGGTGCTATCTTATATTTCTCATATATATTTCATTTTTTTTAGTGTTATTTTAGACGGCAGGCCATTAAATG TGATGTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 444893: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4448931172275N43392AS4SLC470T3Brugia malayi L4 JHU93SL-BmL4


Date: 10:2:25 on Wed 22 Nov 117.