EST 444932 is a singleton


Sequence

>444932 (1 EST) Length=134 ACCCAAGTTTGAGCATAAACCAAAGATTGACCAGGGTTTAGGCACGATATTTGAGTTGCTGATAAATGGACGAGCGAAGG AATACAGCTTGATGTAACAAATATACGGAAACTTNCCNACACTTCTGGATATCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 444932: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4449321172314N43431AS4SLC546T3Brugia malayi L4 JHU93SL-BmL4


Date: 10:44:25 on Sat 18 Nov 117.