EST 444965 is a singleton


Sequence

>444965 (1 EST) Length=190 ACCCAAGTTTGAGGTTATCTGTACTGATACTGAAAAGAGACAGGATGAGATCGGTGAAACATGGAAGAAGAAAATGTCGC CGACGAATTAATTACAGTAAAAATTCAGCTGCTGCAAAAAAGAAGGCAATGAAAAGACGAAAAGCTATGGATGGCATAAC ATGTAAACAGATGCGGATAGCTTGGGACAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 444965: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4449651172347N43464AS4SLC794T3Brugia malayi L4 JHU93SL-BmL4


Date: 21:0:23 on Sun 19 Nov 117.