EST 444978 is a singleton


Sequence

>444978 (1 EST) Length=442 ACCCAAGTTTGAGGCACATCGATGGCAGCAGCATGTACTAGCAGTGGTGTCGCACTACTTCGAATTTCATCACCAACTTA TTCGATTGTTCGTAATTTGTTACGACCAAGACGGGAATATACCATTCCGAGGGATTTACAAGACTGAGGGCGATCTAGTA CGGAAAAATGATCTTCTAGTATGCCAGCATAAGATGAATTTTCATCCTGGCTTAAATGTCTATCTAAAAAGAGATCGAGG TGGACAACTGCTGCTCAAAGCGATGATAGATGGTCACGTGATGATTACTCAAGAAAAAATAAATCCAGATTTTTCTATAC CTGAAATGCTGGTCTACGANGGTATGGAGGAAGTTTATAAATTAACATTTAATGTATTGCCACTGGATATGTCACAATCG TTTAGGTTGTTGAATGAAATTTGATTAAATCTTGGGAACCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 444978: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4449781172360N43477AS4SLC815T3Brugia malayi L4 JHU93SL-BmL4


Date: 6:22:16 on Thu 23 Nov 117.