EST 444984 is a singleton


Sequence

>444984 (1 EST) Length=353 ACCCAAGTTTGAGTATATTAAATCAGGTTGTTGTACTCCTGAAATCTGTTCTGCCTTATTTGGTAGTAGATATTGTTGCA AGAATGAAGAAAATCGCACAGAATGCAGCTGAAAACAGATGTGCTGGGTTGGGACAAATGGAAATGAGCTCGGTTGATTA TAATAATCCGGTCGATACAACTAATGCTCTTATATTACCAGTAAAGACCAAAAAGAAAAAAGTAAGGAAAGCAGACGATA AAGTAATGAATCGGAAAAAAAGTGAAGCAAGGAAAATGCGTCTGGAACAAGCGGAACCTAAAATATCTAAAATTAAGCGG AAGAANCTGATNACTATCCTGACCNNTTTNTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 444984: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4449841172366N43483AS4SLC847T3Brugia malayi L4 JHU93SL-BmL4


Date: 2:11:12 on Thu 23 Nov 117.