EST 444987 is a singleton


Sequence

>444987 (1 EST) Length=370 ACCCAAGTTTGAGAAACAAAATGGCTTGATAAAGTTGCAAGATAAATGCTGCAATGGAAAAATTATTTATGAATGATTGT CATGAGTAAAATACAAGTAATAAAAGATGATAATACTCCGAGAATAGTGTATATGAAATGAATACCGAAGCGATTAATCA GTGCAACAAGTGGAAAATTAGCAATTGAAAAAGCTGTAGCAACTGTTAACGTTAAGTGCGTTACTGAGGGATAAATAGCG ACGATTTACGTGCGTCCAAAGGTTGTCAAAAGCGAGGTTGTTTCTGTTTTTAAATAGTGCTTGTTCATTGTGATATTGTC GTCATTATTTATACACACAGTCACAAAGTTGAATGCTATTATATTAGACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 444987: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4449871172369N43486AS4SLC840T3Brugia malayi L4 JHU93SL-BmL4


Date: 6:19:19 on Fri 24 Nov 117.