EST 444995 is a singleton


Sequence

>444995 (1 EST) Length=196 ACCCAAGTTTGAGCTGACACACTTTATTGTTGTGTATACTACTAGATAGCAGTCATGTCGCCAACAGATGAAACTGCAGC TGCAGAGCTGAAAAAAAAACGTACCTTCAAGAAATTCACATTCTTCCCGCTTTATTCCCCTCAAGTAATGGAAAATTTAT TGTTATGGAGATGACTGATAAATGTTTTGTTTGACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 444995: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4449951172377N43494AS4SLC830T3Brugia malayi L4 JHU93SL-BmL4


Date: 8:30:53 on Wed 22 Nov 117.