EST 445022 is a singleton


Sequence

>445022 (1 EST) Length=81 CTATGGATCGCTGGTCCGGTAAAGTAGCCGTGGTTACGGGTTCCAGTTCCGGAATCGGTGCCGCAATAGAAAAGAAACTN N


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 445022: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4450221172404N43521SW3ICA871SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 19:30:20 on Mon 20 Nov 117.