EST 445045 is a singleton


Sequence

>445045 (1 EST) Length=451 ATTGCAATAGTATTTTTNGTACTGACGACAATTTGTTACGCAACCGTCAAATGTCCGCCAAATAAACGTGGTGAAGTGCT GACGTGCACGATTGCATGTTGCAAAAGTTTGGATGTTACTTTNGAGGATTATTTCTGTTGTGGATTGGAGGACAATGAAA TTGTTGTTCGTGATACGACCTCAGGACATGATCGATCACAGCGTTTCATTGCTTATGGCAGTATTTTTCAGATTGACTAC ACATTACTTATTATTGGATTGATCATTAGCATAATCCTGAGTGTCTTTGCTCACTCTNCTGTTGCCTNCTTGGAAACGGT TGTGGNTTCCACGAGGACGGTATNCCAAGGTNGGTCGGATTCCNNAACAACCCGNTTCCTTTCCAATATTGTTGGGGTTC CGGATTCCCNTTGGAACNNTTGNTTTCCAAAAGGTNCCCCCAANGTCCGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 445045: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4450451182072N43607SW3ICA1173SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 6:9:0 on Sun 19 Nov 117.