EST 445132 is a singleton


Sequence

>445132 (1 EST) Length=136 GTCACTGATTGGATTCTAAATAAGTGATTCTGGATATTCTCTGCTGTGATTTGGNCGATTCTACCAATAGTATTTTTTTT CTCTTGAAATGTNCCATACATATTAAATCCCTNGTTGGAAAAAAAGATGTTTTNCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 445132: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4451321182159N43579SW3ICA992SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 0:0:42 on Sun 19 Nov 117.