EST 445158 is a singleton


Sequence

>445158 (1 EST) Length=313 TATCATGGACATTTGTTTTGCTTTTTTCGATTTTTTGGTTTAAAATTCCTTAAGTGAAAAAGGATNTNTATTTGCGCATC TTTATTTCTATTACTGACTTCTACCGGAAATATATTAAATACATGAAACTTNGTTCTACATGTCGNTTTATGTGAAATAT TGAAGATCGATACGTATGGAAACCCTTNCCAACGAAATATGGAGTGTCCATTTAAATAGCTAAATTTATAGAACTTCAAA TAAGATTTAGATGTCGCTGGAAATTGCTGGGCCTCCTAATTCAAGGACTGGTTATAGTCGAACGGGGNGAGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 445158: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4451581182185N43657SWMFCA164SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 0:27:23 on Fri 24 Nov 117.