EST 445182 is a singleton


Sequence

>445182 (1 EST) Length=159 TCATCCGCAGATATATACGGAAACAAATAGTCGAAGCAAACGAGATAACCATGAGCATAGTTTAGATGACTATTTTCGGA CGCATCTAAGTTGGNTTACGGATGCCCAAAAGGATGAAATCAGGAAAATGAAAGAGGAAGGTAACCAAAAANTGGATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 445182: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4451821182209N43681SW3ICA1162SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 23:16:59 on Mon 20 Nov 117.