EST 445183 is a singleton


Sequence

>445183 (1 EST) Length=340 GAATTTTAATCGACTGTGGTGACNCTGGAGTGGAACAATACATTGATTGTTTGAAGAAAGCACTAGGTAATAACACAATA AAGTTAATTATTTGCACACACTGGCATGGTGATCATGTTGGCGGTATAACAGATATCTTCAAACATGTGACGAATGGGCC AATACCAGTTCATAAACTTAGAAGAATGGATTCGCCAGAGGTGGATAATATAAAATTTGNTTACATATTACCAGGAAGTT TCATTACGGNTCCTGGNGTTNCCCTTAATTGTTTTGNAACACCTGGANATNCATCCGCNCANCTTTCACTTTTTTGGGNG GAGGAGGGTNGTCTCTCCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 445183: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4451831182210N43682SW3ICA1163SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 22:7:57 on Sat 18 Nov 117.