EST 445185 is a singleton


Sequence

>445185 (1 EST) Length=255 CGAATATTACGCATATGCAAATCTAAGAGACTTTTTTATTTNCCATTTATCATTTGGTAAGTGTGTGATTAATGGCTCAT TGTAAATTATTTNGNACTATTTTATAAAAAGGAAATGAAAAACGATAAGAAATATAAGTAAAGTTTTATCACAGAATGCA AAAACTGTCACTGATAAAAATGTGGCATATAATATATAAACTTTTATGGTTTTTTTCACTATTTCACTTCATTTGTTCTC ACTAAATTTGACAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 445185: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4451851182212N43684SW3ICA1165SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 14:1:40 on Mon 20 Nov 117.