EST 445856 is a singleton


Sequence

>445856 (1 EST) Length=516 CAATATCAGTTCGACTANTTTGAGCTCTATTTTACCAGGACAACATTTNACAGCTAGTGAATTACGAGCTCTTTATAGAG CATTTAAGGATACGTTACCTATTGGTCGAGATTCATNCCGTGATATATATGCTAATATTNCCCCNCACGGTGATGCTGAA CAATTTGCTGATTTGATATTTGATAGTATCGTACGTCAACAAGCCGAATGTGTTACGTGTACGGNCTTCGNTGGTGTATG CTCAACTTTGCTCAGGGGAACAGTAGAAGAAAAATTAAGTTGGNTCTACAAATTATATGATCCGAGAAATACCGGTAAAA TTGGATGGGAACGAATTTNTAGGATCATCACCGCTATTGATGACTTAATTGANGNNTGATCACGAAAATAAGGGTTGGGA TATCACGGGAAGATTTTATGATAGNGTGCAGGCAAGATGACGTCTTCTCCAGNCAATACACAATCTCTCACAATTATGAT AAATAGAAGNTNGCCTGCCAGGAAANTAAAANTGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 445856: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4458561182873N44354SW3ICA1190SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 1:44:58 on Sun 19 Nov 117.