EST 445860 is a singleton


Sequence

>445860 (1 EST) Length=482 GAATTCTTGGAAGTTGCAAGTGGTAGAAATTTCAGTCAGTGTCTGATCTCATCCATTTCACCAATGTGTTGGTGGGGGAA CGTGTTGATCAATTTNGTCTTTCTTTTNGCTTCACTCAATGCTTACAGAGAAGACTGCTTCATTAACGTAGGCGGATATG TTTGCTGCGATATGGATATGGTAAAAGTGATGCAAAATGTGATGGAAGAGGATGATAACTTATTAAATGTAGCCAAAAAG ATTCAGGATGATGCGTGGTGGAGAAATGCAAAATTTGAAACCGTCGTGGCTTATGATGATTTTGCTTACAAAACTCTTTT TAAGGCAGGGAAAGCATGCAAAGTGTCGAGAAATGGCATGCAAGCAATTAACTGAGAGCAACAACCAATGACATTCCCTA CCAGCAACTTTTCTTGGTACATATTAAGNCGATGTCTTATTACTTGCCAAGTGATNGCCTGCATTTGGTGATCATGCGCT TT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 445860: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4458601182877N44358SW3ICA1195SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 15:21:19 on Fri 24 Nov 117.