EST 445886 is a singleton


Sequence

>445886 (1 EST) Length=344 TGAGATTTTNGAAATGGCTGCTGTGACNGGAGATAGTATTGAGGTTGACGACGACNTGGAGCTTGAACATACAGACCAAA TTGACGATTTAAAAAGTCGAGTGACAAAGAAGAAGGGACGTGGTTTCGGCGGTGAAACACATGCTGATGTAACGGAGTAT GAAGGTCTGGAGAGTGCAGGAGGTGCAAATAATCCAAATGCTCCTCAAAGATCAGTGGAAGGCTGGATAGTATTTGTGAC AAATGTTCATGAAGAAGCCCATGAGGATGACGTATATGAACGATTCAGCGAATATGGTGAAATTAAAAATATGAATTTGA TTATTGATCGCAGAACGGCTTCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 445886: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4458861182903N44384SW3ICA1252SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 21:6:29 on Sun 19 Nov 117.