EST 445889 is a singleton


Sequence

>445889 (1 EST) Length=429 GTCGAACTGGTCCTGGGGCTTGTTGCAGCAGGCCTGTTCGGCGGCCGCAAGAATCGGGCGATAGCCGGTGCAGCGGCAGA GGTTGCCGGCCAGGGCTTCATGGGCCTTTTGGCTGTCGGGTGCATCACTGTTCTTTTGCAGGGCGAACAGCGACATCACA AAGCCCGGGGTGCAGAAGCCGCATTGCGAACCGTGGCACTCCACCATGGCCTGTTGCACGCTGTGGAGTTGGCCCTGGTG CTTGAGGTCTTCGACGCTGATCAGTTGTTTGCCGTGCAGGGACGAGACAAAACGTCAGGCACGANTTGAGGCTGCGATAG CGATCTTGCTCGGNGCCCTGATCGGCGGTGTGCACTCGCCGANTACCACGGGGCAGGCGCCACAGNCGCCGTTGGGGAAG CCTCCCTTGGGTGCCGGTTTTGGCCNGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 445889: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4458891182906N44387SW3ICA1255SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 2:45:55 on Thu 23 Nov 117.