EST 445928 is a singleton


Sequence

>445928 (1 EST) Length=358 GAAATCCTACCTTGTGAATGCTGTTCAGGAATGAATACTGGAAATATCGCGGGTTCAGTACACTGTCTCCAGGTTAAAAG ATCATTATCCCCAGAAACTCAACGGGTTCTGTCTGATTTGNACATGCATTTACGAAACACTCGAATTCTAAATCTTGGGN GGTATTTATCGACCTCTGACCATCATGTCAATATAGGCGCCCAGTCGACTACCGCAAGGTGTAAAACTAACAGTAAGTTA TGATAACCGAAGGAGATTTATTNCAAAGACAAGAATACATTTTTTNTTTCCACGCATTNAGAACAAATTTNGTNTNCATG TGTGGNCACTNCAACTCTCCAAANATCTNCGATGAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 445928: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4459281182945N44426SW3ICA1235SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 9:39:20 on Thu 23 Nov 117.