EST 445932 is a singleton


Sequence

>445932 (1 EST) Length=190 CAATATTTTTCCGGTATTATTGCAGTAATCGGTTTGACAAATACATTCGTCACCTATACCCCCTTTCCACAAAACGCTTG TTTCACAATATTCTAACAGTGGCTCACTGATTTGTTGACACATTTTTGGTACTCGTAGAATTCCTGAAGTAACTTTNTTA TGCTCTTTATTGATAAATGTNCTGATTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 445932: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4459321182949N44430SW3ICA1240SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 23:3:8 on Fri 24 Nov 117.