EST 445951 is a singleton


Sequence

>445951 (1 EST) Length=130 CTAATTTCGACTACTGGATTATATATGAAAAATGGGCTNCTTGGTTTCCAAACATGTCCCGCAGGATATGAGTGAGGAAC NACAATTTATTGACGAATTGATTGCACTGAAAAAAATAGTAGTANNATCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 445951: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4459511182968N44449SW3ICA1310SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 6:18:18 on Thu 23 Nov 117.