EST 44828 is in sequence 344828


Sequence

>344828 (1 EST) Length=371 CCCCAAANTACAAGGAAGGGTTCGAGCTCGGTACCCGCCAGATCTGTTATCATTAAGATTTATACAATGATGCAACATAA TACAACACCTGATTATTGTCAAGTATATATAAATATAGTCATTTTAGTTTGGTAAAAAAAAAAGGGGAGGTGATAAGTTA GAAAGACAATAGGTGCATCCTTTCGACTTGTTCATAGACAAGTCAATCATAAACATAAATATNCAATGTTGTTCTCTTTA ATTTTCATTGGTTGAATAAGAGGNAGGNNTAANTCTGTATAACTCTTAATGATACCAGTTCTGGCGGGGATCCCCTNGAG TCCGACCTGNCAGCATNCAAGCTTTGGCACTTNGCCCGNCCNCCTTTCACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 344828: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344828974685L47088SCMRAP175C2/25RY adult worm mini-library


Date: 9:45:32 on Fri 24 Nov 117.