EST 457622 is a singleton


Sequence

>457622 (1 EST) Length=171 GATGATCAGAGTAGAAGAGATCGTCACGAGAATCATGAAAAAATCGGATCGGTTTGCATCGGTGACTCATGTCATGGTAC GTCTAAAGATGCAGGATATCGATCGATCGATGCAATTACCGATATGGACGTCGTGTTATGCATAAGATCAACTTAGATAT CGCATTGAGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 457622: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4576221193259N52093KJ4SLB037T3JHU93SL-BmL4 (JHU)


Date: 4:15:37 on Fri 24 Nov 117.