EST 457625 is a singleton


Sequence

>457625 (1 EST) Length=238 AATTACCCAAGTTTNAGAAATAGAATTGATGAAGATGCTNACAGTACTGNTCGACTGTGCATATGATCGATGCATACTGT CCGTTATAGTCAATTTACTGTATGAGATTGTTACTGTACATTTATCTAACCCATAAGATCGTAAATTAATCACAGGATGG AATGTCTAGAATGCATCTTACTGTGAATCATAGTGTGCAGCAGTCAGTATCGTCTGCTAGCTAAGTGAATCGTATCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 457625: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4576251193262N52096KJ4SLB089T3JHU93SL-BmL4 (JHU)


Date: 1:23:23 on Tue 21 Nov 117.