EST 457627 is a singleton


Sequence

>457627 (1 EST) Length=170 CTAGGCACTGATGTGATCNTAGAATCGAGATATAAAGAATATACCAGAAGTAGGATTCACAAGATTACAGTGAGATAGAT CCGTGATGCAGACATCGCGGTTGCATAGATCGCCATGAGCCTAGCAGTCGTACTCAACGCGTACTCATGCTCAGATGCGC TAGCGATCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 457627: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4576271193264N52098KJ4SLB099T3JHU93SL-BmL4 (JHU)


Date: 8:38:23 on Fri 24 Nov 117.