EST 457632 is a singleton


Sequence

>457632 (1 EST) Length=264 CCCAAGTTTGAGGGGCATTAGACACAACCAATTGAGGGTACCAGGATCCTGTACCGATCCAGAATTTCTGTTGACAAAGG ATCCAGAGTTCAGGAAACCTAGCTCAGCTAAGTAAGTAGGAAGAATTTTGTTCGGATATGGTATAGGTACTGATTGTGGT CGCTAAGAAATAGTGCTTGCTGCGTGAATGTTGAAGAGTTTAGCCTCTGCCAACTCAGATATGTGTACGATTCACATAGT TCTCGAGATTGCTGATTCCAGTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 457632: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4576321193269N52103KJ4SLB162T3JHU93SL-BmL4 (JHU)


Date: 2:9:54 on Wed 22 Nov 117.