EST 457638 is a singleton


Sequence

>457638 (1 EST) Length=164 CCCAAGTTTNNGAGAAATAGGCAGTATATGTGAGTGATCAGTATAGTCATGTTACAGACAAAGTGTCTAGCTCGCATCGA CTTGCATAACTCTGGATCGAGTCGGATACTCGTCCNGTATACAGAACAATTTCTTCGTTTGTGCGTCTAGATTATTACTG ATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 457638: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4576381193275N52109KJ4SLB171T3JHU93SL-BmL4 (JHU)


Date: 18:8:24 on Fri 17 Nov 117.