EST 457642 is a singleton


Sequence

>457642 (1 EST) Length=180 TAATGGGTTCAAACTCCCTATTGTTAATCAGCNAAAGTAAATGACTAATACGTCTTGCTGCTTCCTCGTGAACAACTTGA TATATATGGCTCCTTTACAAGAAGTAGTAGCGCATAGCTAACGTCGTCGACTAGTACGTCGACAGCTCTAGCTGAATCAG CTACACCTAGATTTGACCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 457642: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4576421193279N52113KJ4SLB175T3JHU93SL-BmL4 (JHU)


Date: 6:33:2 on Thu 23 Nov 117.