EST 457646 is a singleton


Sequence

>457646 (1 EST) Length=192 TTAATGGGTTCAAACTCTCAAACCACCTGTCAATTGGGTCCTAAATTTAATAGAATTTTATCACTTGTTACACGTAGCGT TTCTGTTGTTGTTGGACATCGAGTTGCGAGCGAAACGTTGTTTAATGGCCACTTTGTTGACCACATGTAGTCTAGGTTAC ATGGTGTAGTAGCTCTGTAATGTCTGTGCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 457646: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4576461193283N52117KJ4SLB181T3JHU93SL-BmL4 (JHU)


Date: 17:51:47 on Tue 21 Nov 117.